migrate in samtools, kraken, vcflib

.travis.yml

@@ -6,6 +6,8 @@ python: 2.7
 env:
   - CHUNK=0
   - CHUNK=1
+  - CHUNK=2
+  - CHUNK=3
 
 before_install:
   - export GALAXY_REPO=https://github.com/galaxyproject/galaxy
@@ -32,7 +34,7 @@ install:
       planemo ci_find_repos --exclude_from .tt_blacklist \
                             --exclude packages --exclude data_managers \
                             --changed_in_commit_range "$TRAVIS_COMMIT_RANGE" \
-                            --chunk_count 2 --chunk "${CHUNK}" \
+                            --chunk_count 4 --chunk "${CHUNK}" \
                             --output changed_repositories_chunk.list
   - cat changed_repositories_chunk.list
 

tool_collections/kraken/README.rst

@@ -0,0 +1,92 @@
+Introduction
+============
+
+`Kraken <http://ccb.jhu.edu/software/kraken/>`__ is a taxonomic sequence
+classifier that assigns taxonomic labels to short DNA reads. It does
+this by examining the :math:`k`-mers within a read and querying a
+database with those :math:`k`-mers. This database contains a mapping of
+every :math:`k`-mer in
+`Kraken <http://ccb.jhu.edu/software/kraken/>`__'s genomic library to
+the lowest common ancestor (LCA) in a taxonomic tree of all genomes that
+contain that :math:`k`-mer. The set of LCA taxa that correspond to the
+:math:`k`-mers in a read are then analyzed to create a single taxonomic
+label for the read; this label can be any of the nodes in the taxonomic
+tree. `Kraken <http://ccb.jhu.edu/software/kraken/>`__ is designed to be
+rapid, sensitive, and highly precise. Our tests on various real and
+simulated data have shown
+`Kraken <http://ccb.jhu.edu/software/kraken/>`__ to have sensitivity
+slightly lower than Megablast with precision being slightly higher. On a
+set of simulated 100 bp reads,
+`Kraken <http://ccb.jhu.edu/software/kraken/>`__ processed over 1.3
+million reads per minute on a single core in normal operation, and over
+4.1 million reads per minute in quick operation.
+
+The latest released version of Kraken will be available at the `Kraken
+website <http://ccb.jhu.edu/software/kraken/>`__, and the latest updates
+to the Kraken source code are available at the `Kraken GitHub
+repository <https://github.com/DerrickWood/kraken>`__.
+
+If you use `Kraken <http://ccb.jhu.edu/software/kraken/>`__ in your
+research, please cite the `Kraken
+paper <http://genomebiology.com/2014/15/3/R46>`__. Thank you!
+
+System Requirements
+===================
+
+Note: Users concerned about the disk or memory requirements should read
+the paragraph about MiniKraken, below.
+
+-  **Disk space**: Construction of Kraken's standard database will
+   require at least 160 GB of disk space. Customized databases may
+   require more or less space. Disk space used is linearly proportional
+   to the number of distinct :math:`k`-mers; as of Feb. 2015, Kraken's
+   default database contains just under 6 billion (6e9) distinct
+   :math:`k`-mers.
+
+   In addition, the disk used to store the database should be
+   locally-attached storage. Storing the database on a network
+   filesystem (NFS) partition can cause Kraken's operation to be very
+   slow, or to be stopped completely. As NFS accesses are much slower
+   than local disk accesses, both preloading and database building will
+   be slowed by use of NFS.
+
+-  **Memory**: To run efficiently, Kraken requires enough free memory to
+   hold the database in RAM. While this can be accomplished using a
+   ramdisk, Kraken supplies a utility for loading the database into RAM
+   via the OS cache. The default database size is 75 GB (as of Feb.
+   2015), and so you will need at least that much RAM if you want to
+   build or run with the default database.
+
+-  **Dependencies**: Kraken currently makes extensive use of Linux
+   utilities such as sed, find, and wget. Many scripts are written using
+   the Bash shell, and the main scripts are written using Perl. Core
+   programs needed to build the database and run the classifier are
+   written in C++, and need to be compiled using g++. Multithreading is
+   handled using OpenMP. Downloads of NCBI data are performed by wget
+   and in some cases, by rsync. Most Linux systems that have any sort of
+   development package installed will have all of the above listed
+   programs and libraries available.
+
+   Finally, if you want to build your own database, you will need to
+   install the
+   `Jellyfish <http://www.cbcb.umd.edu/software/jellyfish/>`__
+   :math:`k`-mer counter. Note that Kraken only supports use of
+   Jellyfish version 1. Jellyfish version 2 is not yet compatible with
+   Kraken.
+
+-  **Network connectivity**: Kraken's standard database build and
+   download commands expect unfettered FTP and rsync access to the NCBI
+   FTP server. If you're working behind a proxy, you may need to set
+   certain environment variables (such as ``ftp_proxy`` or
+   ``RSYNC_PROXY``) in order to get these commands to work properly.
+
+-  **MiniKraken**: To allow users with low-memory computing environments
+   to use Kraken, we supply a reduced standard database that can be
+   downloaded from the Kraken web site. When Kraken is run with a
+   reduced database, we call it MiniKraken.
+
+   The database we make available is only 4 GB in size, and should run
+   well on computers with as little as 8 GB of RAM. Disk space required
+   for this database is also only 4 GB.
+
+

tool_collections/kraken/kraken/.shed.yml

@@ -0,0 +1,16 @@
+categories:
+- Metagenomics
+description: Kraken for taxonomic designation.
+homepage_url: http://ccb.jhu.edu/software/kraken/
+long_description: |
+  Kraken is a system for assigning taxonomic labels to short DNA
+  sequences, usually obtained through metagenomic studies. Previous attempts by other
+  bioinformatics software to accomplish this task have often used sequence alignment
+  or machine learning techniques that were quite slow, leading to the development
+  of less sensitive but much faster abundance estimation programs. Kraken aims to
+  achieve high sensitivity and high speed by utilizing exact alignments of k-mers
+  and a novel classification algorithm.
+name: kraken
+owner: devteam
+remote_repository_url: https://github.com/galaxyproject/tools-iuc/blob/master/tool_collections/kraken/kraken/
+type: unrestricted

tool_collections/kraken/kraken/README.rst

@@ -0,0 +1 @@
+../README.rst

tool_collections/kraken/kraken/kraken.xml

@@ -0,0 +1,164 @@
+<?xml version="1.0"?>
+<tool id="kraken" name="Kraken" version="1.2.1">
+    <description>
+        assign taxonomic labels to sequencing reads
+    </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <expand macro="version_command" />
+    <command>
+        <![CDATA[
+        @SET_DATABASE_PATH@ &&
+        kraken --threads \${GALAXY_SLOTS:-1} @INPUT_DATABASE@ 
+
+        ${only_classified_output}
+
+        #if str( $quick_operation.quick ) == "yes":
+            --quick
+            --min-hits ${quick_operation.min_hits}
+
+        #end if
+
+        #if $single_paired.single_paired_selector == "yes":
+            #if $forward_input.is_of_type( 'fastq' ):
+                --fastq-input
+            #else:
+                --fasta-input
+            #end if
+            "$forward_input" "$reverse_input"
+            ${single_paired.check_names}
+        #elif $single_paired.single_paired_selector == "collection":
+            #if $single_paired.input_pair.forward.is_of_type( 'fastq' ):
+                --fastq-input
+            #else:
+                --fasta-input
+            #end if
+            "${single_paired.input_pair.forward}" "${single_paired.input_pair.reverse}"
+            ${single_paired.check_names}
+        #else:
+            #if $input_sequences.is_of_type( 'fastq' ):
+                --fastq-input
+            #else:
+                --fasta-input
+            #end if
+            "$input_sequences"
+        #end if
+
+        #if $split_reads:
+            --classified-out "${classified_out}" --unclassified-out "${unclassified_out}"
+        #end if
+
+        ## The --output option was changed to redirect as it does not work properly is some situations. For example, on test database the tool classifies 4 reads but does not write them into a file if --output is specified. It does however print correct output into STDOUT. This behavior can be re-created with test database provided in test-data/test_db/ folder. This is the reason for incrementing version number from 1.1.2 to 1.1.3
+
+        > "${output}"
+        ##kraken-translate --db ${kraken_database.fields.name} "${output}" > "${translated}"
+        ]]>
+    </command>
+    <inputs>
+        <conditional name="single_paired">
+            <param name="single_paired_selector" type="select" label="Single or paired reads" help="--paired">
+                <option value="collection">Collection</option>
+                <option value="yes">Paired</option>
+                <option selected="True" value="no">Single</option>
+            </param>
+            <when value="collection">
+                <param format="fasta,fastq" label="Collection of paired reads" name="input_pair" type="data_collection" collection_type="paired" help="FASTA or FASTQ datasets" />
+                <param name="check_names" type="boolean" checked="False" truevalue="--paired --check-names" falsevalue="--paired" label="Verify read names match" help="--check-names" />
+            </when>
+            <when value="yes">
+                <param format="fasta,fastq" label="Forward strand" name="forward_input" type="data" help="FASTA or FASTQ dataset"/>
+                <param format="fasta,fastq" label="Reverse strand" name="reverse_input" type="data" help="FASTA or FASTQ dataset"/>
+                <param name="check_names" type="boolean" checked="False" truevalue="--paired --check-names" falsevalue="--paired" label="Verify read names match" help="--check-names" />
+            </when>
+            <when value="no">
+                <param format="fasta,fastq" label="Input sequences" name="input_sequences" type="data" help="FASTA or FASTQ datasets"/>
+            </when>
+
+        </conditional>
+        <param label="Output classified and unclassified reads?" name="split_reads" type="boolean" help="Sets --unclassified-out and --classified-out"/>
+
+        <conditional name="quick_operation">
+            <param name="quick" type="select" label="Enable quick operation?" help="--quick; Rather than searching all k-mers in a sequence, stop classification after a specified number of database hit">
+                <option value="yes">Yes</option>
+                <option selected="True" value="no">No</option>
+            </param>
+            <when value="yes">
+                <param name="min_hits" type="integer" value="1" label="Number of hits required for classification" help="--min-hits; min-hits will allow you to require multiple hits before declaring a sequence classified, which can be especially useful with custom databases when testing to see if sequences either do or do not belong to a particular genome; default=1"/>
+            </when>
+            <when value="no">
+                <!-- Do absolutely nothing -->
+            </when>
+        </conditional>
+
+        <param name="only_classified_output" type="boolean" checked="False" truevalue="--only-classified-output" falsevalue="" label="Print no Kraken output for unclassified sequences" help="--only-classified-output"/>
+
+        <expand macro="input_database" />
+    </inputs>
+    <outputs>
+        <data format_source="input_sequences" label="${tool.name} on ${on_string}: Classified reads" name="classified_out">
+            <filter>(split_reads)</filter>
+        </data>
+        <data format_source="input_sequences" label="${tool.name} on ${on_string}: Unclassified reads" name="unclassified_out">
+            <filter>(split_reads)</filter>
+        </data>
+        <data format="tabular" label="${tool.name} on ${on_string}: Classification" name="output" />
+        <!--<data format="tabular" label="${tool.name} on ${on_string}: Translated classification" name="translated" />-->
+    </outputs>
+
+    <tests>
+        <test>
+            <param name="single_paired_selector" value="no"/>
+            <param name="input_sequences" value="kraken_test1.fa" ftype="fasta"/>
+            <param name="split_reads" value="false"/>
+            <param name="quick" value="no"/>
+            <param name="only-classified-output" value="false"/>
+            <param name="kraken_database" value="test_db"/>
+            <output name="output" file="kraken_test1_output.tab" ftype="tabular"/>
+        </test>
+    </tests>
+    <help>
+        <![CDATA[
+**What it does**
+
+Kraken is a taxonomic sequence classifier that assigns taxonomic labels to short DNA reads. It does this by examining the k-mers within a read and querying a database with those k-mers. This database contains a mapping of every k-mer in Kraken's genomic library to the lowest common ancestor (LCA) in a taxonomic tree of all genomes that contain that k-mer. The set of LCA taxa that correspond to the k-mers in a read are then analyzed to create a single taxonomic label for the read; this label can be any of the nodes in the taxonomic tree. Kraken is designed to be rapid, sensitive, and highly precise.
+
+-----
+
+**Kraken options**
+
+The Galaxy version of Kraken implements the following options::
+
+
+  --fasta-input             Input is FASTA format
+  --fastq-input             Input is FASTQ format
+  --quick                   Quick operation (use first hit or hits)
+  --min-hits NUM            In quick op., number of hits req'd for classification
+                            NOTE: this is ignored if --quick is not specified
+  --unclassified-out        Print unclassified sequences to filename
+  --classified-out          Print classified sequences to filename
+
+  --only-classified-output  Print no Kraken output for unclassified sequences
+
+------
+
+**Output Format**
+
+Each sequence classified by Kraken results in a single line of output. Output lines contain five tab-delimited fields; from left to right, they are::
+
+    1. "C"/"U": one letter code indicating that the sequence was either classified or unclassified.
+    2. The sequence ID, obtained from the FASTA/FASTQ header.
+    3. The taxonomy ID Kraken used to label the sequence; this is 0 if the sequence is unclassified.
+    4. The length of the sequence in bp.
+    5. A space-delimited list indicating the LCA mapping of each k-mer in the sequence. For example, "562:13 561:4 A:31 0:1 562:3" would indicate that:
+            a) the first 13 k-mers mapped to taxonomy ID #562
+            b) the next 4 k-mers mapped to taxonomy ID #561
+            c) the next 31 k-mers contained an ambiguous nucleotide
+            d) the next k-mer was not in the database
+            e) the last 3 k-mers mapped to taxonomy ID #562
+        ]]>
+    </help>
+    <expand macro="citations" />
+</tool>

tool_collections/kraken/kraken/macros.xml

@@ -0,0 +1 @@
+../macros.xml

tool_collections/kraken/kraken/test-data/kraken_test1.fa

@@ -0,0 +1,70 @@
+>gi|145231|gb|M33724.1|ECOALPHOA Escherichia coli K-12 truncated PhoA (phoA) gene, partial cds; and transposon Mu dI, partial sequence
+CAAAGCTCCGGGCCTCACCCAGGCGCTAAATACCAAAGATGGCGCAGTGATGGTGATGAGTTACGGGAAC
+TCCGAAGAGGATTCACAAGAACATACCGGCAGTCAGTTGCGTATTGCGGCGTATGGCCCGCATGCCGCCA
+ATGAAGCGGCGCACGAAAAACGCGAAAGCGT
+
+>gi|145232|gb|M33725.1|ECOALPHOB Escherichia coli K12 phoA pseudogene and transposon Mu dl-R, partial sequence
+CTGTCATAAAGTTGTCACGGCCGAGACTTATAGTCGCTTTGTTTTTATTTTTTAATGTATTTGTACATGG
+AGAAAATAAAGTGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAA
+GCCCGGACACCAGTGAAGCGGCGCACGAAAAACGCGAAAGCGT
+
+>gi|145234|gb|M33727.1|ECOALPHOE Escherichia coli K12 upstream sequence of psiA5::Mu dI. is identical to psiA30 upstream sequence; putative (phoA) pseudogene and transposon Mu dl-R, partial sequence
+TTGTTTTTATTTTTTAATGTATTTGTACATGGAGAAAATAAAGTGAAACAAAGCACTATTGCACTGGTGA
+AGCGGCGCACGAAAAACGCGAAAGCGT
+
+>gi|146195|gb|J01619.1|ECOGLTA Eschericia coli gltA gene, sdhCDAB operon and sucABCD operons, complete sequence
+GAATTCGACCGCCATTGCGCAAGGCATCGCCATGACCAGGCAGGATACAAAAGAGAGTCGATAAATATTC
+ACGGTGTCCATACCTGATAAATATTTTATGAAAGGCGGCGATGATGCCGCAAAATAATACTTATTTATAA
+TCCAGCACGTAGGTTGCGTTAGCGGTTACTTCACCTGCCGTGACATCGACTGCATTATCAATTTGTTCCA
+TCCAGGCGAAAAAGTTCAGCGTCTGTTCTGATGAGCTTGCATCCAGGTCAAGATCTGGCGCGGCTGAACC
+TAATACGATGTTACCGTCATTTTTGTCCATCAGTCGTACACCGACCCCAGTTGCTTCGCCTGCACTGGTG
+TTGCTCAACAAAGGCGTAGCACCAGTTGTCTTAGCCGTGCTATCGAAGGTTACGCCAAACTTTGGATACC
+GGCATTCCGCTACCGTTGTCAGAAGCAGGCAGATCACAGTTGATCAAGCGAATGTCGACGGCCACTTTAT
+TGCTATGATGCTCCCGGTTTATATGGGTTGTCGTGACTTGTCCAAGATCTATGTTTTTATCAATATCTTC
+TGGATGAATTTCACAAGGTGCTTCAATAACCTCCCCCTTAAAGTGAATTTCGCCAGAACCTTCATCAGCA
+GCATAAACAGGTGCAGTGAACAGCAGAGATACGGCCAGTGCGGCCAATGTTTTTTGTCCTTTAAACATAA
+CAGAGTCCTTTAAGGATATAGAATAGGGGTATAGCTACGCCAGAATATCGTATTTGATTATTGCTAGTTT
+TTAGTTTTGCTTAAAAAATATTGTTAGTTTTATTAAATTGGAAAACTAAATTATTGGTATCATGAATTGT
+TGTATGATGATAAATATAGGGGGGATATGATAGACGTCATTTTCATAGGGTTATAAAATGCGACTACCAT
+GAAGTTTTTAATTCAAAGTATTGGGTTGCTGATAATTTGAGCTGTTCTATTCTTTTTAAATATCTATATA
+GGTCTGTTAATGGATTTTATTTTTACAAGTTTTTTGTGTTTAGGCATATAAAAATCAAGCCCGCCATATG
+AACGGCGGGTTAAAATATTTACAACTTAGCAATCGAACCATTAACGCTTGATATCGCTTTTAAAGTCGCG
+TTTTTCATATCCTGTATACAGCTGACGCGGACGGGCAATCTTCATACCGTCACTGTGCATTTCGCTCCAG
+TGGGCGATCCAGCCAACGGTACGTGCCATTGCGAAAATGACGGTGAACATGGAAGACGGAATACCCATCG
+CTTTCAGGATGATACCAGAGTAGAAATCGACGTTCGGGTACAGTTTCTTCTCGATAAAGTACGGGTCGTT
+CAGCGCGATGTTTTCCAGCTCCATAGCCACTTCCAGCAGGTCATCCTTCGTGCCCAGCTCTTTCAGCACT
+TCATGGCAGGTTTCACGCATTACGGTGGCGCGCGGGTCGTAATTTTTGTACACGCGGTGACCGAAGCCCA
+TCAGGCGGAAAGAATCATTTTTGTCTTTCGCACGACGAAAAAATTCCGGAATGTGTTTAACGGAGCTGAT
+TTCTTCCAGCATTTTCAGCGCCGCTTCGTTAGCACCGCCGTGCGCAGGTCCCCACAGTGAAGCAATACCT
+GCTGCGATACAGGCAAACGGGTTCGCACCCGAAGAGCCAGCGGTACGCACGGTGGAGGTAGAGGCGTTCT
+GTTCATGGTCAGCGTGCAGGATCAGAATACGGTCCATAGCACGTTCCAGAATCGGATTAACTTCATACGG
+TTCGCACGGCGTGGAGAACATCATATTCAGGAAGTTACCGGCGTAGGAGAGATCGTTGCGCGGGTAAACA
+AATGGCTGACCAATGGAATACTTGTAACACATCGCGGCCATGGTCGGCATTTTCGACAGCAGGCGGAACG
+CGGCAATTTCACGGTGACGAGGATTGTTAACATCCAGCGAGTCGTGATAGAACGCCGCCAGCGCGCCGGT
+AATACCACACATGACTGCCATTGGATGCGAGTCGCGACGGAAAGCATGGAACAGACGGGTAATCTGCTCG
+TGGATCATGGTATGACGGGTCACCGTAGTTTTAAATTCGTCATACTGTTCCTGAGTCGGTTTTTCACCAT
+TCAGCAGGATGTAACAAACTTCCAGGTAGTTAGAATCGGTCGCCAGCTGATCGATCGGGAAACCGCGGTG
+CAGCAAAATACCTTCATCACCATCAATAAAAGTAATTTTAGATTCGCAGGATGCGGTTGAAGTGAAGCCT
+GGGTCAAAGGTGAACACACCTTTTGAACCGAGAGTACGGATATCAATAACATCTTGACCCAGCGTGCCTT
+TCAGCACATCCAGTTCAACAGCTGTATCCCCGTTGAGGGTGAGTTTTGCTTTTGTATCAGCCATTTAAGG
+TCTCCTTAGCGCCTTATTGCGTAAGACTGCCGGAACTTAAATTTGCCTTCGCACATCAACCTGGCTTTAC
+CCGTTTTTTATTTGGCTCGCCGCTCTGTGAAAGAGGGGAAAACCTGGGTACAGAGCTCTGGGCGCTTGCA
+GGTAAAGGATCCATTGATGACGAATAAATGGCGAATCAAGTACTTAGCAATCCGAATTATTAAACTTGTC
+TACCACTAATAACTGTCCCGAATGAATTGGTCAATACTCCACACTGTTACATAAGTTAATCTTAGGTGAA
+ATACCGACTTCATAACTTTTACGCATTATATGCTTTTCCTGGTAATGTTTGTAACAACTTTGTTGAATGA
+TTGTCAAATTAGATGATTAAAAATTAAATAAATGTTGTTATCGTGACCTGGATCACTGTTCAGGATAAAA
+CCCGACAAACTATATGTAGGTTAATTGTAATGATTTTGTGAACAGCCTATACTGCCGCCAGTCTCCGGAA
+CACCCTGCAATCCCGAGCCACCCAGCGTTGTAACGTGTCGTTTTCGCATCTGGAAGCAGTGTTTTGCATG
+ACGCGCAGTTATAGAAAGGACGCTGTCTGACCCGCAAGCAGACCGGAGGAAGGAAATCCCGACGTCTCCA
+GGTAACAGAAAGTTAACCTCTGTGCCCGTAGTCCCCAGGGAATAATAAGAACAGCATGTGGGCGTTATTC
+ATGATAAGAAATGTGAAAAAACAAAGACCTGTTAATCTGGACCTACAGACCATCCGGTTCCCCATCACGG
+CGATAGCGTCCATTCTCCATCGCGTTTCCGGTGTGATCACCTTTGTTGCAGTGGGCATCCTGCTGTGGCT
+TCTGGGTACCAGCCTCTCTTCCCCTGAAGGTTTCGAGCAAGCTTCCGCGATTATGGGCAGCTTCTTCGTC
+AAATTTATCATGTGGGGCATCCTTACCGCTCTGGCGTATCACGTCGTCGTAGGTATTCGCCACATGATGA
+TGGATTTTGGCTATCTGGAAGAAACATTCGAAGCGGGTAAACGCTCCGCCAAAATCTCCTTTGTTATTAC
+TGTCGTGCTTTCACTTCTCGCAGGAGTCCTCGTATGGTAAGCAACGCCTCCGCATTAGGACGCAATGGCG
+TACATGATTTCATCCTCGTTCGCGCTACCGCTATCGTCCTGACGCTCTACATCATTTATATGGTCGGTTT
+TTTCGCTACCAGTGGCGAGCTGACATATGAAGTCTGGATCGGTTTCTTCGCCTCTGCGTTCACCAAAGTG
+TTCACCCTGCTGGCGCTGTTTTCTATCTTGATCCATGCCTGGATCGGCATGTGGCAGGTGTTGACCGACT
+ACGTTAAACCGCTGGCTTTGCGCCTGATGCTGCAACTGGTGATTGTCGTTGCACTGGTGGTTTACGTGAT
+TTATGGATTCGTTGTGGTGTGGGGTGTGTGATGAAATTGCCAGTCAGAGAATTTGATGCAGTTGTGATTG

tool_collections/kraken/kraken/test-data/kraken_test1_output.tab

@@ -0,0 +1,4 @@
+C	gi|145231|gb|M33724.1|ECOALPHOA	83333	171	83333:162
+C	gi|145232|gb|M33725.1|ECOALPHOB	83333	183	83333:174
+C	gi|145234|gb|M33727.1|ECOALPHOE	83333	97	83333:88
+C	gi|146195|gb|J01619.1|ECOGLTA	83333	3850	83333:3841

tool_collections/kraken/kraken/test-data/test_database.loc

@@ -0,0 +1 @@
+../../test_database.loc

tool_collections/kraken/kraken/test-data/test_db/database.idx

@@ -0,0 +1 @@
+../../../database.idx